ID: 938595729

View in Genome Browser
Species Human (GRCh38)
Location 2:132785345-132785367
Sequence TGGAGCAATGCTAAGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938595725_938595729 2 Left 938595725 2:132785320-132785342 CCTGCAGCTCTGGTTTGGAACTG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 175
938595723_938595729 10 Left 938595723 2:132785312-132785334 CCATGTGGCCTGCAGCTCTGGTT 0: 1
1: 0
2: 3
3: 29
4: 257
Right 938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938595729 Original CRISPR TGGAGCAATGCTAAGGTGGA AGG Exonic
905407043 1:37740842-37740864 AGGAGCCATGATAAGGTGAAGGG + Intronic
907526429 1:55056612-55056634 TTGAGCAAGGCTAATGTGAATGG + Intronic
907722078 1:56981456-56981478 TGAAGGAATGCACAGGTGGAGGG - Intergenic
908144495 1:61225074-61225096 TGGAGCAAACTTAAGGTGGAAGG - Intronic
908322563 1:62992278-62992300 TGCAGCAAGGCAAATGTGGACGG - Intergenic
910429581 1:87147792-87147814 TGGAGATATTCTAAGGTGTAAGG + Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
914251013 1:145921375-145921397 AGGAGAAATGCTAGGGAGGATGG + Intergenic
916699354 1:167275129-167275151 TGGGGGAAGGCTGAGGTGGAAGG - Intronic
921115092 1:212082497-212082519 TGGAGCAATGTTAAGCATGAGGG + Intronic
923031449 1:230252158-230252180 TAGAGCAGTGCTAAGGAGAAAGG - Intronic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1063781325 10:9328417-9328439 AGGAAAAATGCAAAGGTGGAAGG - Intergenic
1065943140 10:30583167-30583189 GGGAGCAATGCCAAGGTTGGAGG - Intergenic
1066696936 10:38087438-38087460 TGGAGCAAAGCTGGGGTGGAAGG - Intergenic
1066995625 10:42560285-42560307 TGGAGCAAAGCTGGGGTGGGAGG + Intergenic
1067183537 10:44008008-44008030 GGGAGCATTTCAAAGGTGGAAGG + Intergenic
1069288007 10:66741245-66741267 TGGATCAATGGCTAGGTGGAAGG + Intronic
1070001183 10:72378671-72378693 TGGAGCAATGCAGAGGAGCAAGG + Intronic
1071500517 10:86200396-86200418 TGGAGCAGTGTCAGGGTGGAAGG + Intronic
1074976629 10:118586880-118586902 TGGAGCCAGGCTAGGATGGAGGG - Intergenic
1077108246 11:851070-851092 TGGAGCAGAGCTGAGGTAGAGGG + Intronic
1078044912 11:7904861-7904883 TCTAGCAATCCTAAGGTGAATGG + Intergenic
1080046356 11:27812499-27812521 TGCAGCCATGCGGAGGTGGATGG + Intergenic
1080714929 11:34790909-34790931 TGCAGAAATGCTCAGCTGGATGG - Intergenic
1081677580 11:44979895-44979917 TGGAGGCATGAAAAGGTGGAGGG + Intergenic
1084445141 11:69199288-69199310 TAGAGCAATGGTGAGATGGAGGG - Intergenic
1085040219 11:73322488-73322510 TGGAGCAATGGTGAGATGCATGG - Intronic
1090766560 11:129881228-129881250 TGGACCAAAGCTGAGATGGAAGG - Intronic
1093984847 12:25519208-25519230 TTTAGCAGTGCTTAGGTGGAGGG - Intronic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1097918022 12:65040457-65040479 TGGTACTATGCTAAGGTGGCTGG + Intergenic
1098429354 12:70402701-70402723 AGGAGAAATGCACAGGTGGACGG + Intronic
1099272659 12:80530945-80530967 TGAAGGAAGGCTAAGGTGGTAGG + Intronic
1099519439 12:83642301-83642323 AGGAGCAAAGCTAGGCTGGATGG + Intergenic
1100734851 12:97515537-97515559 TGGTACAATGCTAAGGTGATGGG - Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1102308377 12:111824274-111824296 TCTAGCAATCCTAAGGTGAATGG + Intergenic
1104416705 12:128601673-128601695 TGGAGTCGTCCTAAGGTGGAAGG + Intronic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1107432401 13:40351827-40351849 TGGAGGGTTGCTGAGGTGGAAGG - Intergenic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113209015 13:107953019-107953041 TGGAGCAATGCTTGAGGGGATGG + Intergenic
1114223384 14:20716846-20716868 TGATGAAATGCTAGGGTGGAAGG + Intergenic
1121385183 14:93514644-93514666 TAAAGAAATGCTAAGGCGGATGG - Intronic
1124220284 15:27845295-27845317 TGGAGGAAAGCTAAGGAGAATGG + Intronic
1124874525 15:33579432-33579454 TTGATTAATCCTAAGGTGGAAGG - Intronic
1125587727 15:40833009-40833031 TGGGTCAGTGCTAAGTTGGAAGG - Intergenic
1125880212 15:43186886-43186908 TGCAGTAATTCTAAGTTGGAAGG - Intronic
1126645157 15:50868478-50868500 TGGTGCAATACAAAGGTGGTGGG - Intergenic
1132474795 16:129201-129223 TGGAGTAAGGCTAATGTGGGGGG + Intronic
1133511490 16:6462209-6462231 TGGAGGACTGCGAAGGTAGATGG - Intronic
1133631316 16:7624846-7624868 TGGAGAAATGCCAAGGTTGTTGG + Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1137728439 16:50672656-50672678 TAAAGCAATTCCAAGGTGGAAGG + Exonic
1138502698 16:57457840-57457862 TGTAGCATTGGTAAAGTGGAAGG + Intronic
1139544289 16:67642385-67642407 TGGAGCCATGCCCAGGTGGAGGG - Intergenic
1139675645 16:68521403-68521425 AGGAGGAAGGCTAAGGTGAAAGG - Intergenic
1140456481 16:75108788-75108810 TGAAGGAATGCTAAGGAGGTAGG - Exonic
1142397592 16:89841311-89841333 TAGTGCCATGCTAAGGTGGGAGG - Intronic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1143485185 17:7250372-7250394 TGGAGAAAAGCTAAGGGAGAGGG + Intronic
1146805224 17:35859536-35859558 TGGAGGAGTGCAAAGGTGGCAGG - Intronic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1152720147 17:81919539-81919561 TGGGGCAAAGTTAAGGTGGAAGG + Exonic
1152853948 17:82653258-82653280 TGGAGCAATGTTAAGATTGCTGG + Intergenic
1155876815 18:31099975-31099997 TGGAGAGAGGCTAAGGTGGGAGG - Intronic
1155895699 18:31323375-31323397 TGGAGTAAGGGTGAGGTGGATGG - Intronic
1156572572 18:38275007-38275029 TGGAGCCATTTGAAGGTGGAGGG + Intergenic
1163157732 19:15448658-15448680 TGGAGAAATGGTAAGATTGATGG - Intronic
1163767903 19:19173501-19173523 TGGATCAGTGCTAAGCTGGAAGG - Intronic
1166624809 19:44341493-44341515 TGGAAGAAGGCTAAGATGGAAGG - Intronic
1167826374 19:51977290-51977312 TCTAGCAATCCTAAGGTGAATGG - Intronic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
925264856 2:2559917-2559939 TGCAGCAGTGCTCAGTTGGAGGG - Intergenic
926819410 2:16836077-16836099 TGGAGTAGAGCTAAGGAGGATGG + Intergenic
930991876 2:57665990-57666012 TTGACAAATGCTAAGTTGGAGGG - Intergenic
932208223 2:69903049-69903071 TGGCGGAAGGCTAAGGTGGGAGG - Intronic
933257970 2:80102302-80102324 TGGGACAAGGCCAAGGTGGAAGG - Intronic
933432786 2:82205574-82205596 TGGGGCAATGCTAATGTAAATGG - Intergenic
933975390 2:87505088-87505110 TGCAGCGATGCTATGGGGGAGGG + Intergenic
936318436 2:111445725-111445747 TGCAGCGATGCTATGGGGGAGGG - Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938929710 2:136075926-136075948 TCTAGCAATCCTAAGGTGAATGG + Intergenic
939153711 2:138501279-138501301 TGGAGCAGTTTTCAGGTGGAGGG - Intergenic
939565745 2:143784749-143784771 TGTGGCAATGCTAAGAGGGAGGG + Intergenic
944580184 2:201125572-201125594 TGGGGCAGTGGAAAGGTGGAAGG + Intronic
945150337 2:206784044-206784066 TGGAGAAATGTTGAGGTGGGAGG - Intronic
946307626 2:218865198-218865220 TGGAGAAATGCCACTGTGGAGGG + Intronic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948416141 2:237805869-237805891 TGGGGGAGTGCTAAGGTGGGAGG + Intronic
948628098 2:239283115-239283137 AGGAGCAATGCTGAGGCTGAGGG + Intronic
1173384391 20:42574534-42574556 TGGAGCAATGGTAACTTGCAGGG - Intronic
1174649150 20:52110124-52110146 TGGAGCACTTCTCAGGTGGCTGG - Intronic
1174887797 20:54354703-54354725 TGGAGCACTGCCATGTTGGAAGG + Intergenic
1176414230 21:6465994-6466016 TGGTGAATTGCAAAGGTGGAGGG - Intergenic
1179017423 21:37605508-37605530 TGGATGAATGCATAGGTGGATGG - Intergenic
1179461362 21:41537639-41537661 TGGAGCAGTGCTAAGGGAGTGGG - Intergenic
1179689728 21:43074316-43074338 TGGTGAATTGCAAAGGTGGAGGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181149106 22:20870072-20870094 TGGCGCCATGTTAAGATGGATGG - Intronic
1184982453 22:48104122-48104144 TGGATCAATGTCAAGTTGGAGGG - Intergenic
949310247 3:2689391-2689413 TGGAGCAAGCCTATGGTAGAGGG + Intronic
950215986 3:11159817-11159839 TGGATGGATGCTAACGTGGAGGG + Intronic
950390635 3:12693899-12693921 TGCAGGATTCCTAAGGTGGAGGG + Intergenic
950898685 3:16476711-16476733 TGGAGCAATGCCACAGTCGAAGG + Intronic
952377056 3:32776683-32776705 TGGAGCCATCCTAAGCTGCAGGG + Intergenic
953488477 3:43326027-43326049 TGAAGGAATGCTGAGTTGGAAGG + Intronic
953747428 3:45585844-45585866 AGGAGCATTGCTAATGTAGAAGG - Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954945816 3:54423529-54423551 GAGAGCAATGCTTATGTGGAGGG + Intronic
955236000 3:57139754-57139776 TGGAGGAAGGCTGAGGTGGGCGG - Intronic
957487873 3:80886412-80886434 TGGAGCAAAACTAAGGTGCCTGG + Intergenic
961459378 3:127040522-127040544 TGGAGAAGTGCGCAGGTGGAGGG + Intergenic
961662131 3:128474844-128474866 TGAATCAATGCAAAGGTGGAGGG - Intergenic
963085782 3:141435034-141435056 TGGGGGAAAGCTGAGGTGGAAGG + Intronic
969424906 4:7118473-7118495 TGGAGGAATGGAAAGATGGATGG + Intergenic
970305932 4:14732879-14732901 TGGAGAAAAGCAAAGCTGGAAGG + Intergenic
971075015 4:23138307-23138329 TGGAGAAATGCTAAGGAGCTGGG - Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971317577 4:25580403-25580425 TGGTGCAAGGCTGAGGTGGGAGG - Intergenic
972002447 4:34055926-34055948 TATAGCAATGCAAATGTGGACGG + Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
976603957 4:86965021-86965043 TGGAGGAGTGCTGATGTGGAGGG + Intronic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981503385 4:145475877-145475899 TTGAGCAATGCCAAGATGTAGGG - Intergenic
985926338 5:3022614-3022636 AGGAGCTTTGCAAAGGTGGACGG - Intergenic
986044926 5:4027562-4027584 TGGAGCAAAGCAAGGGTGGCAGG - Intergenic
986567130 5:9126255-9126277 TGGAGCAATCCTTAGTTGAAGGG + Intronic
986645095 5:9909446-9909468 AGGAGCTATGCTACGTTGGAAGG + Intergenic
987948848 5:24650688-24650710 TCTAGCAATCCTAAGGTGAATGG - Intergenic
988461160 5:31439103-31439125 TGGAGAAATGATAAGTTGTATGG + Intronic
990447401 5:55905352-55905374 TGCAGCAAGGCAGAGGTGGAAGG - Intronic
993092385 5:83442096-83442118 TGAAGCAATGTAAAGATGGAAGG + Intergenic
993504772 5:88695302-88695324 TGGAACAGTGCGAAGTTGGAAGG - Intergenic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
995042949 5:107609766-107609788 TGGAGGAGGGCTAAGGTGGAAGG - Intronic
996315601 5:122157462-122157484 GGGAGAAATGCTGTGGTGGAAGG + Intronic
1000873188 5:166602763-166602785 AGGATCAATGCTCAGTTGGATGG + Intergenic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1001240949 5:170069439-170069461 GGCAGCAATGCTATGCTGGATGG + Intronic
1001264253 5:170261011-170261033 TGGGCCAAGGCCAAGGTGGATGG + Intronic
1001776814 5:174335093-174335115 TGGAGCAGGGCTTAGGTGGCTGG - Intergenic
1002039691 5:176503661-176503683 TGGTGCAATGCTAAGATAAAAGG + Intronic
1002834855 6:857487-857509 TGGAGGAATGGATAGGTGGATGG - Intergenic
1003022591 6:2524029-2524051 TGCAGCAATTCTGAGGTGAAGGG - Intergenic
1003846211 6:10176328-10176350 AGGAGAGATGCTAAAGTGGATGG + Intronic
1008128220 6:47691980-47692002 AGGAGCAAAGCTAAATTGGAAGG - Intronic
1009555170 6:65154312-65154334 AGGAGCAAAGAAAAGGTGGAAGG + Intronic
1011570887 6:88733253-88733275 TGGAAGAAGGCTGAGGTGGAAGG + Intronic
1014332595 6:120088319-120088341 TGGAGGAATGCTAATTTGTAAGG - Intergenic
1015490914 6:133824562-133824584 TGGAGTAAAGCTGATGTGGATGG - Intergenic
1015573279 6:134644116-134644138 TGGAGCTATTCTAAGCTGAATGG - Intergenic
1016235390 6:141857643-141857665 TGGAGGGATGCAAATGTGGAGGG + Intergenic
1017714061 6:157195815-157195837 TGTTGCAAGGCTGAGGTGGATGG + Intronic
1017793357 6:157821117-157821139 TGGTGGAGGGCTAAGGTGGAAGG - Intronic
1020740372 7:12008840-12008862 TGCATCAATGCTGATGTGGAAGG + Intergenic
1021566973 7:22025705-22025727 TGGAGCAATGGTGAGCTGGTGGG - Intergenic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1028978292 7:96938535-96938557 TACAGCATTGCTAAGGTGCAGGG - Intergenic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1035948521 8:3992670-3992692 ACAAGGAATGCTAAGGTGGAAGG + Intronic
1041954160 8:63538853-63538875 TGAAGCAAAGCTAAGTTAGAAGG + Intergenic
1042332899 8:67599805-67599827 TGGAGAAATGCTCAGCTAGAGGG + Intronic
1042854320 8:73250571-73250593 TCAAGCAATGCTAAGTGGGAGGG + Intronic
1046956396 8:120066970-120066992 AGGATCAATGCTAAGGTACAAGG + Intronic
1048685376 8:136899173-136899195 TGGAGCTATGTTCTGGTGGAAGG - Intergenic
1049921064 9:364725-364747 TGGAGCAATGATATAGTGGGTGG + Intronic
1050131060 9:2413293-2413315 TGGAGTAATTCTGAGGTGGGAGG + Intergenic
1050474638 9:6027798-6027820 AGAAGCAATGCTTAGGGGGAGGG + Intergenic
1051409066 9:16770138-16770160 TGGCTCAATGCTAACCTGGAAGG + Intronic
1051447742 9:17158984-17159006 TAAAGCAGTGCTAAGATGGAAGG - Intronic
1052374309 9:27700636-27700658 TGGAGCAAAGTTGAGGGGGAAGG + Intergenic
1056984222 9:91346436-91346458 TAGAGCAAAGTTAGGGTGGAGGG - Intronic
1058184183 9:101834971-101834993 TGGAGCCATGATAGGGTAGATGG - Intergenic
1060017777 9:120101813-120101835 TGGTGCAATGCTGAGGTGCATGG - Intergenic
1062633884 9:137479750-137479772 TGCAGCAATGGCCAGGTGGAAGG + Intronic
1185624871 X:1474392-1474414 TGGATCAGTGTTTAGGTGGATGG + Intronic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190722608 X:53162522-53162544 TCTAGCAATCCTAAGGTGAATGG + Intergenic
1199672123 X:150156055-150156077 TGGAGCAATCCAATGGTGGATGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1201277003 Y:12308277-12308299 TGGAGAATTGTTAAGGTGGTAGG - Intergenic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic
1202075101 Y:21029638-21029660 TCCAGCAATCCTAAGGTGAATGG + Intergenic