ID: 938598414

View in Genome Browser
Species Human (GRCh38)
Location 2:132812275-132812297
Sequence CCTTCATCACGGAGGACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938598414_938598421 26 Left 938598414 2:132812275-132812297 CCTCCGGTCCTCCGTGATGAAGG No data
Right 938598421 2:132812324-132812346 ATCCTTATGGTCACTTTATGAGG No data
938598414_938598419 13 Left 938598414 2:132812275-132812297 CCTCCGGTCCTCCGTGATGAAGG No data
Right 938598419 2:132812311-132812333 TTTTCCTTATTTAATCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938598414 Original CRISPR CCTTCATCACGGAGGACCGG AGG (reversed) Intronic
No off target data available for this crispr