ID: 938599782

View in Genome Browser
Species Human (GRCh38)
Location 2:132825381-132825403
Sequence TTTTGTCTTCCTCTTAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938599782_938599793 -3 Left 938599782 2:132825381-132825403 CCACCCCTAAGAGGAAGACAAAA No data
Right 938599793 2:132825401-132825423 AAAATCTGGAGGGGGAAGGGAGG No data
938599782_938599792 -6 Left 938599782 2:132825381-132825403 CCACCCCTAAGAGGAAGACAAAA No data
Right 938599792 2:132825398-132825420 ACAAAAATCTGGAGGGGGAAGGG No data
938599782_938599791 -7 Left 938599782 2:132825381-132825403 CCACCCCTAAGAGGAAGACAAAA No data
Right 938599791 2:132825397-132825419 GACAAAAATCTGGAGGGGGAAGG No data
938599782_938599794 22 Left 938599782 2:132825381-132825403 CCACCCCTAAGAGGAAGACAAAA No data
Right 938599794 2:132825426-132825448 ACTAAGAGTTAAAACGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938599782 Original CRISPR TTTTGTCTTCCTCTTAGGGG TGG (reversed) Intronic
No off target data available for this crispr