ID: 938606624

View in Genome Browser
Species Human (GRCh38)
Location 2:132900055-132900077
Sequence GTTCTGAGTGCACCACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938606624_938606629 23 Left 938606624 2:132900055-132900077 CCAGTTGGTGGTGCACTCAGAAC No data
Right 938606629 2:132900101-132900123 CCTTATATAGGTGTGCTTCATGG No data
938606624_938606626 11 Left 938606624 2:132900055-132900077 CCAGTTGGTGGTGCACTCAGAAC No data
Right 938606626 2:132900089-132900111 GTACCATGTGCACCTTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938606624 Original CRISPR GTTCTGAGTGCACCACCAAC TGG (reversed) Intronic
No off target data available for this crispr