ID: 938610071

View in Genome Browser
Species Human (GRCh38)
Location 2:132938354-132938376
Sequence TGCACTCATGTGTATACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938610071_938610076 9 Left 938610071 2:132938354-132938376 CCATGTGTATACACATGAGTGCA No data
Right 938610076 2:132938386-132938408 TAGAGAATCCAGGGCTTTCATGG No data
938610071_938610074 0 Left 938610071 2:132938354-132938376 CCATGTGTATACACATGAGTGCA No data
Right 938610074 2:132938377-132938399 TTTCCAGGTTAGAGAATCCAGGG No data
938610071_938610073 -1 Left 938610071 2:132938354-132938376 CCATGTGTATACACATGAGTGCA No data
Right 938610073 2:132938376-132938398 ATTTCCAGGTTAGAGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938610071 Original CRISPR TGCACTCATGTGTATACACA TGG (reversed) Intronic
No off target data available for this crispr