ID: 938610695

View in Genome Browser
Species Human (GRCh38)
Location 2:132944934-132944956
Sequence CAGGAGTTAGAGAGGCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938610692_938610695 -3 Left 938610692 2:132944914-132944936 CCAGGCAGCAGAGATGGGTTCAG No data
Right 938610695 2:132944934-132944956 CAGGAGTTAGAGAGGCTCTTTGG No data
938610688_938610695 3 Left 938610688 2:132944908-132944930 CCTTACCCAGGCAGCAGAGATGG No data
Right 938610695 2:132944934-132944956 CAGGAGTTAGAGAGGCTCTTTGG No data
938610691_938610695 -2 Left 938610691 2:132944913-132944935 CCCAGGCAGCAGAGATGGGTTCA No data
Right 938610695 2:132944934-132944956 CAGGAGTTAGAGAGGCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938610695 Original CRISPR CAGGAGTTAGAGAGGCTCTT TGG Intronic
No off target data available for this crispr