ID: 938614859

View in Genome Browser
Species Human (GRCh38)
Location 2:132987161-132987183
Sequence AGAGCCAGTGGAGGACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938614859_938614864 6 Left 938614859 2:132987161-132987183 CCTGTGTGTCCTCCACTGGCTCT No data
Right 938614864 2:132987190-132987212 CTTCTTTGTCTTCTCGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938614859 Original CRISPR AGAGCCAGTGGAGGACACAC AGG (reversed) Intronic
No off target data available for this crispr