ID: 938615522

View in Genome Browser
Species Human (GRCh38)
Location 2:132993749-132993771
Sequence CAGAGGTGTGACATTTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938615522_938615527 15 Left 938615522 2:132993749-132993771 CCACCTTAAATGTCACACCTCTG No data
Right 938615527 2:132993787-132993809 TCACCTCCTCAGCCAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938615522 Original CRISPR CAGAGGTGTGACATTTAAGG TGG (reversed) Intronic
No off target data available for this crispr