ID: 938619000

View in Genome Browser
Species Human (GRCh38)
Location 2:133030239-133030261
Sequence CATCTCATGATGAAGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938618998_938619000 -4 Left 938618998 2:133030220-133030242 CCTTGGGGGTCACAGGGGCCATC No data
Right 938619000 2:133030239-133030261 CATCTCATGATGAAGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938619000 Original CRISPR CATCTCATGATGAAGTATTC TGG Intronic
No off target data available for this crispr