ID: 938624629

View in Genome Browser
Species Human (GRCh38)
Location 2:133094878-133094900
Sequence TAGGGGTCATCTGCATTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938624629_938624639 17 Left 938624629 2:133094878-133094900 CCACGGAATGCAGATGACCCCTA No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data
938624629_938624637 16 Left 938624629 2:133094878-133094900 CCACGGAATGCAGATGACCCCTA No data
Right 938624637 2:133094917-133094939 CCCTCTGAGAGCAAGAAAATGGG No data
938624629_938624635 15 Left 938624629 2:133094878-133094900 CCACGGAATGCAGATGACCCCTA No data
Right 938624635 2:133094916-133094938 CCCCTCTGAGAGCAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938624629 Original CRISPR TAGGGGTCATCTGCATTCCG TGG (reversed) Intronic