ID: 938624632

View in Genome Browser
Species Human (GRCh38)
Location 2:133094897-133094919
Sequence GGGGGCTACTCTAAACTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938624632_938624637 -3 Left 938624632 2:133094897-133094919 CCTAGAAGTTTAGAGTAGCCCCC No data
Right 938624637 2:133094917-133094939 CCCTCTGAGAGCAAGAAAATGGG No data
938624632_938624635 -4 Left 938624632 2:133094897-133094919 CCTAGAAGTTTAGAGTAGCCCCC No data
Right 938624635 2:133094916-133094938 CCCCTCTGAGAGCAAGAAAATGG No data
938624632_938624639 -2 Left 938624632 2:133094897-133094919 CCTAGAAGTTTAGAGTAGCCCCC No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938624632 Original CRISPR GGGGGCTACTCTAAACTTCT AGG (reversed) Intronic