ID: 938624639

View in Genome Browser
Species Human (GRCh38)
Location 2:133094918-133094940
Sequence CCTCTGAGAGCAAGAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938624631_938624639 -1 Left 938624631 2:133094896-133094918 CCCTAGAAGTTTAGAGTAGCCCC No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data
938624628_938624639 24 Left 938624628 2:133094871-133094893 CCATGTGCCACGGAATGCAGATG No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data
938624629_938624639 17 Left 938624629 2:133094878-133094900 CCACGGAATGCAGATGACCCCTA No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data
938624632_938624639 -2 Left 938624632 2:133094897-133094919 CCTAGAAGTTTAGAGTAGCCCCC No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data
938624630_938624639 0 Left 938624630 2:133094895-133094917 CCCCTAGAAGTTTAGAGTAGCCC No data
Right 938624639 2:133094918-133094940 CCTCTGAGAGCAAGAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938624639 Original CRISPR CCTCTGAGAGCAAGAAAATG GGG Intronic