ID: 938625455

View in Genome Browser
Species Human (GRCh38)
Location 2:133104056-133104078
Sequence CAGAGCTGCCCCTCCCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938625449_938625455 6 Left 938625449 2:133104027-133104049 CCTTAAAGAGTCTTTCCATATTT No data
Right 938625455 2:133104056-133104078 CAGAGCTGCCCCTCCCAAGTGGG No data
938625451_938625455 -9 Left 938625451 2:133104042-133104064 CCATATTTCTGGCCCAGAGCTGC No data
Right 938625455 2:133104056-133104078 CAGAGCTGCCCCTCCCAAGTGGG No data
938625448_938625455 7 Left 938625448 2:133104026-133104048 CCCTTAAAGAGTCTTTCCATATT No data
Right 938625455 2:133104056-133104078 CAGAGCTGCCCCTCCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938625455 Original CRISPR CAGAGCTGCCCCTCCCAAGT GGG Intronic
No off target data available for this crispr