ID: 938626994

View in Genome Browser
Species Human (GRCh38)
Location 2:133121307-133121329
Sequence GATGCACAAGACTAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938626993_938626994 -5 Left 938626993 2:133121289-133121311 CCAGTTGTTTTTTTAACAGATGC No data
Right 938626994 2:133121307-133121329 GATGCACAAGACTAAACTGAAGG No data
938626992_938626994 27 Left 938626992 2:133121257-133121279 CCTGTAGGTTCAAAGAAACTTAA No data
Right 938626994 2:133121307-133121329 GATGCACAAGACTAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938626994 Original CRISPR GATGCACAAGACTAAACTGA AGG Intronic