ID: 938627175

View in Genome Browser
Species Human (GRCh38)
Location 2:133123622-133123644
Sequence TGCCCTCTGTATTCATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938627173_938627175 -6 Left 938627173 2:133123605-133123627 CCAAATCAACAGAAAATTGCCCT 0: 1
1: 0
2: 1
3: 17
4: 208
Right 938627175 2:133123622-133123644 TGCCCTCTGTATTCATCAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938627175 Original CRISPR TGCCCTCTGTATTCATCAGG AGG Intronic
901333529 1:8429001-8429023 TGCCGTTTGTACTCATCAGTAGG - Intronic
902029172 1:13409016-13409038 TGCATTCAGCATTCATCAGGAGG - Intergenic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
904259284 1:29279260-29279282 TGCCCTGTGTATTCTAGAGGAGG + Intronic
908878309 1:68702476-68702498 GGCCCTCTGTCATCATGAGGTGG + Intergenic
910649695 1:89552728-89552750 TGCTCCCTGTGTTCACCAGGCGG + Intronic
918388532 1:184036090-184036112 TGGGCTCTGTCTTCCTCAGGGGG + Intronic
922093151 1:222416846-222416868 TGCCATCTGTAGTCATGAAGGGG + Intergenic
923439138 1:233999012-233999034 TGCCGTCTGTATTGAGCATGAGG - Intronic
924730080 1:246703267-246703289 TTCCTTCTGTATTTATCAGCTGG - Intergenic
1064353968 10:14601529-14601551 TGTCCTCTGTGTGCATCATGGGG - Intronic
1066255753 10:33677006-33677028 CTCCCTCTGTCTTCATTAGGTGG - Intergenic
1066667319 10:37797346-37797368 TGCCCTATGTTTTCCTCAAGGGG - Intronic
1068555515 10:58454420-58454442 GGTCCTCTGGATTCATCATGAGG - Intergenic
1068569578 10:58614641-58614663 TTCCCTTTTTATTCATCTGGAGG + Intronic
1071205357 10:83269535-83269557 TGCCCTGTGTATCCATCAAATGG - Intergenic
1073727158 10:106246787-106246809 TACCTTTTGTATTCTTCAGGTGG + Intergenic
1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG + Intronic
1076155318 10:128200418-128200440 TTCCCTCTGGCTGCATCAGGTGG - Intergenic
1084838894 11:71828908-71828930 TACCGTCTCTAATCATCAGGGGG + Intergenic
1085023190 11:73221769-73221791 TGACCTCTGTACTCATCCAGCGG + Intronic
1089374183 11:117982958-117982980 TGCCCTCTCCACTCATCTGGGGG + Intergenic
1092916703 12:13196025-13196047 TGCTCTCTGTAATAATCAGCTGG - Intergenic
1095414884 12:41965618-41965640 TGCCCTCAGGATCCATTAGGTGG - Intergenic
1100216482 12:92455399-92455421 TTCCCTCTGTATTAGTCAGCTGG + Intergenic
1103217931 12:119217687-119217709 TGTCCTCAGTTTTCTTCAGGTGG + Intronic
1104905974 12:132213743-132213765 TGGCCTCTGCATTCTCCAGGTGG + Intronic
1108463613 13:50692827-50692849 TTCCTTCTGTATTTATCAGATGG - Intronic
1109372067 13:61435593-61435615 GGCCCTCTGTAGTCAACTGGAGG - Intergenic
1110445309 13:75573589-75573611 TGTCCTGTGTATTCATATGGAGG + Intronic
1115987385 14:39115907-39115929 TACTCTCTGTCTTCCTCAGGAGG - Intronic
1115990699 14:39146596-39146618 TCCTCTCTGTATTGATCATGTGG - Intergenic
1117118876 14:52547696-52547718 TGCCTTATGTGTTCAACAGGGGG + Intronic
1117505656 14:56400259-56400281 TGACCTCTGTACTCATTAGAAGG - Intergenic
1118688781 14:68318079-68318101 TTCTTTCTGAATTCATCAGGTGG + Intronic
1120041178 14:79754459-79754481 TTCCCTCTGTATCCATCAAGGGG - Intronic
1121592054 14:95122772-95122794 TTTCCTTTGTATTCATCAGAAGG + Intronic
1122145760 14:99688032-99688054 TGCCCTCTGTCTTCCTGAGATGG + Intronic
1125234765 15:37500346-37500368 TTCACTCTGTATTCATCATCTGG - Intergenic
1127321550 15:57851604-57851626 TGGCTTCTGTACACATCAGGAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128729897 15:70014075-70014097 TGCCCTGTGGATTTGTCAGGAGG - Intergenic
1128991674 15:72265893-72265915 AGAACTCTGTATCCATCAGGTGG - Exonic
1134595409 16:15491931-15491953 TGCTGTCTGTCTTCATCAGGAGG + Intronic
1139581169 16:67874469-67874491 TGCCCTCTTTACTCATGAGTTGG + Intronic
1143831179 17:9652686-9652708 TGTCTTCTGTATTCATCAATAGG + Intronic
1147408959 17:40235275-40235297 TTCCTTCTGGATTCATCTGGAGG - Intronic
1151355238 17:73554148-73554170 TGCCCCCTGTCCTCATCAGGGGG - Intronic
1155873292 18:31053690-31053712 TGGGCTGTGTTTTCATCAGGAGG + Intergenic
1159366700 18:67475523-67475545 TCCCCTCTATATTTATCAGCAGG - Intergenic
1160866135 19:1256935-1256957 GGTCCTCTGTGTTCAGCAGGTGG + Intronic
1164997569 19:32733765-32733787 TTCCTTCTGCATTCATCAGCTGG + Intronic
1165421114 19:35722465-35722487 GGCCCTCAGTATGCATCGGGAGG + Exonic
925314972 2:2914550-2914572 TGCCATCTGTCTTCATGAGATGG - Intergenic
927864146 2:26578000-26578022 TGCCCTCTGTATCCACCAGAGGG - Intronic
928177281 2:29043306-29043328 TCTCCTCTGTATCCCTCAGGAGG + Intronic
928383912 2:30847505-30847527 AGGCCTCTTTAGTCATCAGGTGG - Intergenic
928768007 2:34670975-34670997 TGGGCTCTGTAGTCAGCAGGTGG - Intergenic
931081130 2:58772399-58772421 CTCCCTCTGTATTCCTCATGGGG - Intergenic
932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG + Intronic
932592253 2:73074527-73074549 ATCCCTATGTATTCAACAGGTGG + Exonic
932891099 2:75598053-75598075 TGCCCTTTGCATCCAACAGGGGG + Intergenic
936585349 2:113752270-113752292 TTCCCTCTGTATTTATTAGCTGG - Intronic
938627175 2:133123622-133123644 TGCCCTCTGTATTCATCAGGAGG + Intronic
939138492 2:138324614-138324636 TGCCCTGTGAATTCACCAGATGG + Intergenic
940108211 2:150122170-150122192 TGCCTGCTTTATTCATCTGGGGG - Intergenic
1169591643 20:7149325-7149347 TGCCCCCTGTTTTTATCAGCGGG + Intergenic
1171344344 20:24454158-24454180 TGCTCTCAGTATTAATCAGAAGG + Intergenic
1172099361 20:32475968-32475990 TGTCCTCTGGATTCAGCAGAGGG - Intronic
1181387202 22:22555178-22555200 TGGCCTCTGAGCTCATCAGGTGG + Intronic
1181504435 22:23342389-23342411 AGCCCTTTGTTTTCCTCAGGAGG + Intergenic
1181655551 22:24295001-24295023 AGCCCTTTGTTTTCCTCAGGAGG + Intronic
1181709431 22:24672620-24672642 AGCCCTTTGTTTTCCTCAGGAGG + Intergenic
1183614761 22:38937209-38937231 TGCCCTCTGGAAGCATCAGATGG - Intergenic
1184001963 22:41681556-41681578 TTCCCTCTTTATTTATTAGGCGG - Intronic
950162033 3:10767503-10767525 TGCCCACTGGAATCATGAGGAGG + Intergenic
956055406 3:65293329-65293351 TGCTCTGTGGAGTCATCAGGGGG + Intergenic
957714384 3:83906173-83906195 TGCTATCTGTATCCATCAGAGGG + Intergenic
960124530 3:113984042-113984064 TGTCCTCTATATTCAGCAAGAGG - Intronic
963991299 3:151658277-151658299 TGCCCTTTCTCTTCATGAGGAGG + Intergenic
965599568 3:170441824-170441846 TTCCCTCTGAAATCCTCAGGTGG - Intronic
971073169 4:23117989-23118011 TGACATCTGCATTCATCTGGAGG - Intergenic
972657292 4:41076677-41076699 TGTCATCTTTATTCATGAGGAGG - Intronic
974258685 4:59496238-59496260 TGCCCTGTGTATCTATAAGGTGG - Intergenic
975425117 4:74216305-74216327 TGCCCACTAGAATCATCAGGAGG + Intronic
985947846 5:3200648-3200670 TCCCTTCTGTCTTCAGCAGGTGG + Intergenic
987067892 5:14307816-14307838 TTCCTTCTGTATTTATTAGGTGG + Intronic
987977166 5:25029160-25029182 GGCCCTCTGCCATCATCAGGAGG - Intergenic
989096501 5:37786559-37786581 TGCCATCTATATTCTGCAGGGGG + Intergenic
990091632 5:52058292-52058314 TGGACTCTGTATTCAATAGGTGG - Intronic
990738723 5:58890968-58890990 TGCCCTCTGTGCTCTTAAGGGGG + Intergenic
991038936 5:62156525-62156547 TCCCCTCTGTGTTGACCAGGTGG - Intergenic
997078370 5:130708276-130708298 TGCCCTCTCTATTTTTAAGGTGG - Intergenic
997527427 5:134562349-134562371 TGCCCTATGGATTCCTGAGGTGG + Exonic
998112496 5:139512989-139513011 TGCCATCTGTGTTCATAAAGAGG - Intergenic
1004069996 6:12289118-12289140 TGCCCTGTGTGTACTTCAGGGGG + Intergenic
1005211488 6:23469808-23469830 TGTCTTCTGTCTTCTTCAGGTGG - Intergenic
1005222968 6:23609095-23609117 TTCCCTCTGCATATATCAGGTGG - Intergenic
1012189884 6:96266176-96266198 TGCCCACTCTGTTCCTCAGGAGG + Intergenic
1014078765 6:117265653-117265675 CGCGCTCTGGAGTCATCAGGCGG - Exonic
1021599273 7:22348685-22348707 TACCCTCTGTCTTCATGAGAAGG - Intronic
1023033223 7:36108988-36109010 TGCCCTCCTTATTCCCCAGGTGG + Intergenic
1023360094 7:39406683-39406705 TGCCCTCTCCAGTCTTCAGGGGG + Exonic
1024633354 7:51267084-51267106 TGGCCTCTGTATTTATGCGGTGG - Intronic
1026933435 7:74238017-74238039 TGACCTCTGGAGCCATCAGGAGG - Intronic
1031131935 7:117842978-117843000 AGCCCTCTGTATTCATGGGCTGG + Intronic
1034943745 7:155248839-155248861 GGCCTCCTGTATTCATCAGTCGG + Intergenic
1036277735 8:7370357-7370379 TACCATCTCTAATCATCAGGGGG + Intronic
1036343791 8:7941543-7941565 TACCATCTCTAATCATCAGGGGG - Intronic
1036808842 8:11853476-11853498 TGCCCTCTGTCCTCTCCAGGTGG - Exonic
1036839132 8:12102310-12102332 TACCATCTCTAATCATCAGGGGG - Intergenic
1036860921 8:12348553-12348575 TACCATCTCTAATCATCAGGGGG - Intergenic
1038065086 8:23955558-23955580 AGCCCTCTTTCATCATCAGGTGG - Intergenic
1039619732 8:38985550-38985572 TGCCCTCTGATTTCACTAGGGGG - Intronic
1040996351 8:53406764-53406786 TGAGCTCTGTTTTCATCAGATGG + Intergenic
1043865652 8:85372249-85372271 TGCACTTTGTACTCATCAGACGG + Intronic
1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG + Intergenic
1045219339 8:100182265-100182287 TGCCCTCTGTCTTTAGCAGTGGG + Intronic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1046280581 8:112024293-112024315 ATCCTTCTGTATGCATCAGGAGG + Intergenic
1049828219 8:144684358-144684380 TGCCCTCTATAGACAGCAGGTGG - Intergenic
1051593960 9:18805394-18805416 TGTTTTCTGTATTCATCAGAAGG + Intronic
1060839833 9:126784607-126784629 TGCGTTCTGTAAGCATCAGGAGG - Intergenic
1187024170 X:15416741-15416763 TGGCCTCTGACTTCATCAGAAGG - Intronic
1188644455 X:32547753-32547775 TGAGCTCTGTAATAATCAGGAGG - Intronic
1191006703 X:55717633-55717655 TGCCGTCTGTCATCATCACGTGG - Intergenic
1192376028 X:70563151-70563173 TGCCCTGTGTATGCATTAGAAGG - Intronic
1197715149 X:129701216-129701238 TGCCATCTGTATTCATCCAGGGG + Intergenic
1202193591 Y:22272011-22272033 TTCCAACTGTATTCATCTGGAGG - Intergenic