ID: 938630225

View in Genome Browser
Species Human (GRCh38)
Location 2:133158839-133158861
Sequence CCAGTGCCCAGAAGAGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938630225_938630230 -6 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630230 2:133158856-133158878 CACTGGTGCTAGGGTCAAAAGGG No data
938630225_938630233 25 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630233 2:133158887-133158909 TAAAGAAGAAATACAATGCATGG No data
938630225_938630231 -1 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630231 2:133158861-133158883 GTGCTAGGGTCAAAAGGGAGAGG No data
938630225_938630232 0 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630232 2:133158862-133158884 TGCTAGGGTCAAAAGGGAGAGGG No data
938630225_938630229 -7 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630229 2:133158855-133158877 GCACTGGTGCTAGGGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938630225 Original CRISPR CCAGTGCCCAGAAGAGCAGT AGG (reversed) Intronic
No off target data available for this crispr