ID: 938630231

View in Genome Browser
Species Human (GRCh38)
Location 2:133158861-133158883
Sequence GTGCTAGGGTCAAAAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938630225_938630231 -1 Left 938630225 2:133158839-133158861 CCTACTGCTCTTCTGGGCACTGG No data
Right 938630231 2:133158861-133158883 GTGCTAGGGTCAAAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938630231 Original CRISPR GTGCTAGGGTCAAAAGGGAG AGG Intronic
No off target data available for this crispr