ID: 938630416

View in Genome Browser
Species Human (GRCh38)
Location 2:133160642-133160664
Sequence GGCTGAAGAGCTTTCGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938630416_938630419 8 Left 938630416 2:133160642-133160664 CCAGCATCGAAAGCTCTTCAGCC No data
Right 938630419 2:133160673-133160695 ACCCTCCAATGTGGACAGACTGG No data
938630416_938630418 -1 Left 938630416 2:133160642-133160664 CCAGCATCGAAAGCTCTTCAGCC No data
Right 938630418 2:133160664-133160686 CAGTAATTTACCCTCCAATGTGG No data
938630416_938630423 18 Left 938630416 2:133160642-133160664 CCAGCATCGAAAGCTCTTCAGCC No data
Right 938630423 2:133160683-133160705 GTGGACAGACTGGCCCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938630416 Original CRISPR GGCTGAAGAGCTTTCGATGC TGG (reversed) Intronic
No off target data available for this crispr