ID: 938635754

View in Genome Browser
Species Human (GRCh38)
Location 2:133224472-133224494
Sequence CACATATGACTGTTGTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938635754_938635756 16 Left 938635754 2:133224472-133224494 CCCTACTACAACAGTCATATGTG No data
Right 938635756 2:133224511-133224533 TTAGATGCTCCATATAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938635754 Original CRISPR CACATATGACTGTTGTAGTA GGG (reversed) Intronic
No off target data available for this crispr