ID: 938637174

View in Genome Browser
Species Human (GRCh38)
Location 2:133241063-133241085
Sequence GTTTCAAGCCTGTGACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938637173_938637174 0 Left 938637173 2:133241040-133241062 CCTCAACACAGGATTTACTTTCT No data
Right 938637174 2:133241063-133241085 GTTTCAAGCCTGTGACTAGCAGG No data
938637171_938637174 30 Left 938637171 2:133241010-133241032 CCTTACTATTTTCTTATTCTAGA No data
Right 938637174 2:133241063-133241085 GTTTCAAGCCTGTGACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938637174 Original CRISPR GTTTCAAGCCTGTGACTAGC AGG Intronic
No off target data available for this crispr