ID: 938639316

View in Genome Browser
Species Human (GRCh38)
Location 2:133263946-133263968
Sequence GCAAATTAAGCAAAATGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639316_938639319 29 Left 938639316 2:133263946-133263968 CCTACTCATTTTGCTTAATTTGC No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639316 Original CRISPR GCAAATTAAGCAAAATGAGT AGG (reversed) Intronic
No off target data available for this crispr