ID: 938639317

View in Genome Browser
Species Human (GRCh38)
Location 2:133263975-133263997
Sequence AGTGTTAGCACAAAGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639317_938639319 0 Left 938639317 2:133263975-133263997 CCCAGCAACTTTGTGCTAACACT No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data
938639317_938639324 25 Left 938639317 2:133263975-133263997 CCCAGCAACTTTGTGCTAACACT No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data
938639317_938639322 6 Left 938639317 2:133263975-133263997 CCCAGCAACTTTGTGCTAACACT No data
Right 938639322 2:133264004-133264026 CCATTTTAGATCCTAGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639317 Original CRISPR AGTGTTAGCACAAAGTTGCT GGG (reversed) Intronic
No off target data available for this crispr