ID: 938639318

View in Genome Browser
Species Human (GRCh38)
Location 2:133263976-133263998
Sequence AAGTGTTAGCACAAAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639318_938639322 5 Left 938639318 2:133263976-133263998 CCAGCAACTTTGTGCTAACACTT No data
Right 938639322 2:133264004-133264026 CCATTTTAGATCCTAGGATAAGG No data
938639318_938639319 -1 Left 938639318 2:133263976-133263998 CCAGCAACTTTGTGCTAACACTT No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data
938639318_938639324 24 Left 938639318 2:133263976-133263998 CCAGCAACTTTGTGCTAACACTT No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639318 Original CRISPR AAGTGTTAGCACAAAGTTGC TGG (reversed) Intronic
No off target data available for this crispr