ID: 938639319

View in Genome Browser
Species Human (GRCh38)
Location 2:133263998-133264020
Sequence TTCATCCCATTTTAGATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639316_938639319 29 Left 938639316 2:133263946-133263968 CCTACTCATTTTGCTTAATTTGC No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data
938639318_938639319 -1 Left 938639318 2:133263976-133263998 CCAGCAACTTTGTGCTAACACTT No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data
938639317_938639319 0 Left 938639317 2:133263975-133263997 CCCAGCAACTTTGTGCTAACACT No data
Right 938639319 2:133263998-133264020 TTCATCCCATTTTAGATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639319 Original CRISPR TTCATCCCATTTTAGATCCT AGG Intronic
No off target data available for this crispr