ID: 938639321

View in Genome Browser
Species Human (GRCh38)
Location 2:133264004-133264026
Sequence CCTTATCCTAGGATCTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639321_938639329 25 Left 938639321 2:133264004-133264026 CCATTTTAGATCCTAGGATAAGG No data
Right 938639329 2:133264052-133264074 TCCACCTCCAGCAGTTCACCAGG No data
938639321_938639324 -4 Left 938639321 2:133264004-133264026 CCATTTTAGATCCTAGGATAAGG No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639321 Original CRISPR CCTTATCCTAGGATCTAAAA TGG (reversed) Intronic
No off target data available for this crispr