ID: 938639324

View in Genome Browser
Species Human (GRCh38)
Location 2:133264023-133264045
Sequence AAGGCAATAGTCCAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639321_938639324 -4 Left 938639321 2:133264004-133264026 CCATTTTAGATCCTAGGATAAGG No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data
938639317_938639324 25 Left 938639317 2:133263975-133263997 CCCAGCAACTTTGTGCTAACACT No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data
938639320_938639324 -3 Left 938639320 2:133264003-133264025 CCCATTTTAGATCCTAGGATAAG No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data
938639318_938639324 24 Left 938639318 2:133263976-133263998 CCAGCAACTTTGTGCTAACACTT No data
Right 938639324 2:133264023-133264045 AAGGCAATAGTCCAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639324 Original CRISPR AAGGCAATAGTCCAGAGCCC TGG Intronic
No off target data available for this crispr