ID: 938639766

View in Genome Browser
Species Human (GRCh38)
Location 2:133266468-133266490
Sequence CGCAGGGGGCGCGCCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938639753_938639766 12 Left 938639753 2:133266433-133266455 CCAGGTGCCGAAGGGCTGGGGCT No data
Right 938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG No data
938639756_938639766 5 Left 938639756 2:133266440-133266462 CCGAAGGGCTGGGGCTAGGGTGG No data
Right 938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938639766 Original CRISPR CGCAGGGGGCGCGCCTGGGC GGG Intronic
No off target data available for this crispr