ID: 938642460

View in Genome Browser
Species Human (GRCh38)
Location 2:133295198-133295220
Sequence ACCACCTGCTTCACTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938642460_938642462 3 Left 938642460 2:133295198-133295220 CCAGTACCAGTGAAGCAGGTGGT No data
Right 938642462 2:133295224-133295246 AGTCATATGTATTCTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938642460 Original CRISPR ACCACCTGCTTCACTGGTAC TGG (reversed) Intronic
No off target data available for this crispr