ID: 938643364

View in Genome Browser
Species Human (GRCh38)
Location 2:133306087-133306109
Sequence GGATCCACAAAATTCCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938643364_938643373 23 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643373 2:133306133-133306155 ACAATGGAGGGTGGTAGCATTGG No data
938643364_938643375 25 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643375 2:133306135-133306157 AATGGAGGGTGGTAGCATTGGGG No data
938643364_938643371 14 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643371 2:133306124-133306146 TCCAAGAAAACAATGGAGGGTGG No data
938643364_938643374 24 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643374 2:133306134-133306156 CAATGGAGGGTGGTAGCATTGGG No data
938643364_938643376 29 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643376 2:133306139-133306161 GAGGGTGGTAGCATTGGGGCTGG No data
938643364_938643369 10 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643369 2:133306120-133306142 TAACTCCAAGAAAACAATGGAGG No data
938643364_938643370 11 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643370 2:133306121-133306143 AACTCCAAGAAAACAATGGAGGG No data
938643364_938643368 7 Left 938643364 2:133306087-133306109 CCTAGGGGGAATTTTGTGGATCC No data
Right 938643368 2:133306117-133306139 GATTAACTCCAAGAAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938643364 Original CRISPR GGATCCACAAAATTCCCCCT AGG (reversed) Intronic
No off target data available for this crispr