ID: 938643424

View in Genome Browser
Species Human (GRCh38)
Location 2:133306753-133306775
Sequence GGCAACAGGTTTTGGTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938643419_938643424 8 Left 938643419 2:133306722-133306744 CCTACCATGAAATGGTGCTTCAG No data
Right 938643424 2:133306753-133306775 GGCAACAGGTTTTGGTGTATTGG No data
938643418_938643424 9 Left 938643418 2:133306721-133306743 CCCTACCATGAAATGGTGCTTCA No data
Right 938643424 2:133306753-133306775 GGCAACAGGTTTTGGTGTATTGG No data
938643420_938643424 4 Left 938643420 2:133306726-133306748 CCATGAAATGGTGCTTCAGAGAA No data
Right 938643424 2:133306753-133306775 GGCAACAGGTTTTGGTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938643424 Original CRISPR GGCAACAGGTTTTGGTGTAT TGG Intronic
No off target data available for this crispr