ID: 938644280

View in Genome Browser
Species Human (GRCh38)
Location 2:133315260-133315282
Sequence CATGCTAAGTTGTTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938644273_938644280 28 Left 938644273 2:133315209-133315231 CCACTGGAAGGAGATCAACATCA No data
Right 938644280 2:133315260-133315282 CATGCTAAGTTGTTGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938644280 Original CRISPR CATGCTAAGTTGTTGGATTC AGG Intronic
No off target data available for this crispr