ID: 938644975

View in Genome Browser
Species Human (GRCh38)
Location 2:133321085-133321107
Sequence CAAGACATGGGTCAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938644975_938644984 10 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644984 2:133321118-133321140 GGTGGACTGCTCAGGAATAAAGG No data
938644975_938644985 11 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644985 2:133321119-133321141 GTGGACTGCTCAGGAATAAAGGG No data
938644975_938644986 12 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644986 2:133321120-133321142 TGGACTGCTCAGGAATAAAGGGG No data
938644975_938644987 29 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644987 2:133321137-133321159 AAGGGGTTTCCAGCTGCCTGAGG No data
938644975_938644979 -8 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644979 2:133321100-133321122 ATGTCTTGCCTTATCCCAGGTGG No data
938644975_938644981 2 Left 938644975 2:133321085-133321107 CCTGATCACTGACCCATGTCTTG No data
Right 938644981 2:133321110-133321132 TTATCCCAGGTGGACTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938644975 Original CRISPR CAAGACATGGGTCAGTGATC AGG (reversed) Intronic
No off target data available for this crispr