ID: 938646417

View in Genome Browser
Species Human (GRCh38)
Location 2:133335153-133335175
Sequence CATGGATACCAGGAAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938646417_938646423 -9 Left 938646417 2:133335153-133335175 CCCAACCCTTCCTGGTATCCATG No data
Right 938646423 2:133335167-133335189 GTATCCATGGAATGTCTCAGTGG No data
938646417_938646426 -2 Left 938646417 2:133335153-133335175 CCCAACCCTTCCTGGTATCCATG No data
Right 938646426 2:133335174-133335196 TGGAATGTCTCAGTGGTATTGGG No data
938646417_938646425 -3 Left 938646417 2:133335153-133335175 CCCAACCCTTCCTGGTATCCATG No data
Right 938646425 2:133335173-133335195 ATGGAATGTCTCAGTGGTATTGG No data
938646417_938646427 11 Left 938646417 2:133335153-133335175 CCCAACCCTTCCTGGTATCCATG No data
Right 938646427 2:133335187-133335209 TGGTATTGGGATACAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938646417 Original CRISPR CATGGATACCAGGAAGGGTT GGG (reversed) Intronic
No off target data available for this crispr