ID: 938662566

View in Genome Browser
Species Human (GRCh38)
Location 2:133502864-133502886
Sequence CCTCACTCCCCAGGCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938662566_938662571 -4 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG No data
938662566_938662573 3 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662573 2:133502890-133502912 CTCCCTGCAGAGGAGGGACTTGG No data
938662566_938662577 14 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662577 2:133502901-133502923 GGAGGGACTTGGATGGAAGTTGG No data
938662566_938662570 -7 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662570 2:133502880-133502902 AGTGAGGTGGCTCCCTGCAGAGG No data
938662566_938662576 7 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662576 2:133502894-133502916 CTGCAGAGGAGGGACTTGGATGG No data
938662566_938662572 -3 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662572 2:133502884-133502906 AGGTGGCTCCCTGCAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938662566 Original CRISPR CCTCACTCCCCAGGCACACT TGG (reversed) Intronic
No off target data available for this crispr