ID: 938662571

View in Genome Browser
Species Human (GRCh38)
Location 2:133502883-133502905
Sequence GAGGTGGCTCCCTGCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938662566_938662571 -4 Left 938662566 2:133502864-133502886 CCAAGTGTGCCTGGGGAGTGAGG No data
Right 938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938662571 Original CRISPR GAGGTGGCTCCCTGCAGAGG AGG Intronic
No off target data available for this crispr