ID: 938664719

View in Genome Browser
Species Human (GRCh38)
Location 2:133522826-133522848
Sequence ACATTAACACTACTCGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938664719_938664721 4 Left 938664719 2:133522826-133522848 CCATAACCGAGTAGTGTTAATGT No data
Right 938664721 2:133522853-133522875 TCTATGTCTTCCAACATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938664719 Original CRISPR ACATTAACACTACTCGGTTA TGG (reversed) Intronic