ID: 938664721

View in Genome Browser
Species Human (GRCh38)
Location 2:133522853-133522875
Sequence TCTATGTCTTCCAACATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938664717_938664721 21 Left 938664717 2:133522809-133522831 CCTGCACCTACAAAGAGCCATAA No data
Right 938664721 2:133522853-133522875 TCTATGTCTTCCAACATCTCTGG No data
938664719_938664721 4 Left 938664719 2:133522826-133522848 CCATAACCGAGTAGTGTTAATGT No data
Right 938664721 2:133522853-133522875 TCTATGTCTTCCAACATCTCTGG No data
938664720_938664721 -2 Left 938664720 2:133522832-133522854 CCGAGTAGTGTTAATGTCTTTTC No data
Right 938664721 2:133522853-133522875 TCTATGTCTTCCAACATCTCTGG No data
938664718_938664721 15 Left 938664718 2:133522815-133522837 CCTACAAAGAGCCATAACCGAGT No data
Right 938664721 2:133522853-133522875 TCTATGTCTTCCAACATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938664721 Original CRISPR TCTATGTCTTCCAACATCTC TGG Intronic