ID: 938665493

View in Genome Browser
Species Human (GRCh38)
Location 2:133531104-133531126
Sequence GTCTTCACATCCTTTACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938665493_938665501 24 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665501 2:133531151-133531173 AGGAATGGTGAAAGGGAATGAGG No data
938665493_938665500 17 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665500 2:133531144-133531166 AGAAGGGAGGAATGGTGAAAGGG No data
938665493_938665495 0 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665495 2:133531127-133531149 TGAAAGAAAAAAAAGGAAGAAGG No data
938665493_938665494 -7 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665494 2:133531120-133531142 TGAAGACTGAAAGAAAAAAAAGG No data
938665493_938665497 4 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665497 2:133531131-133531153 AGAAAAAAAAGGAAGAAGGGAGG No data
938665493_938665502 28 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG No data
938665493_938665496 1 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665496 2:133531128-133531150 GAAAGAAAAAAAAGGAAGAAGGG No data
938665493_938665498 9 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665498 2:133531136-133531158 AAAAAGGAAGAAGGGAGGAATGG No data
938665493_938665499 16 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665499 2:133531143-133531165 AAGAAGGGAGGAATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938665493 Original CRISPR GTCTTCACATCCTTTACTGA AGG (reversed) Intronic
No off target data available for this crispr