ID: 938665502

View in Genome Browser
Species Human (GRCh38)
Location 2:133531155-133531177
Sequence ATGGTGAAAGGGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938665493_938665502 28 Left 938665493 2:133531104-133531126 CCTTCAGTAAAGGATGTGAAGAC No data
Right 938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938665502 Original CRISPR ATGGTGAAAGGGAATGAGGA AGG Intronic
No off target data available for this crispr