ID: 938666246

View in Genome Browser
Species Human (GRCh38)
Location 2:133540869-133540891
Sequence GAGGTGCAGCAAGCCGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938666239_938666246 27 Left 938666239 2:133540819-133540841 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 938666246 2:133540869-133540891 GAGGTGCAGCAAGCCGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938666246 Original CRISPR GAGGTGCAGCAAGCCGAGAT TGG Intronic
No off target data available for this crispr