ID: 938681743

View in Genome Browser
Species Human (GRCh38)
Location 2:133699313-133699335
Sequence GCTCTCACCATTCCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938681738_938681743 7 Left 938681738 2:133699283-133699305 CCTCTATCCCAGGAGAAAGCAGG No data
Right 938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG No data
938681741_938681743 -1 Left 938681741 2:133699291-133699313 CCAGGAGAAAGCAGGAATCTCAG No data
Right 938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG No data
938681740_938681743 0 Left 938681740 2:133699290-133699312 CCCAGGAGAAAGCAGGAATCTCA No data
Right 938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG No data
938681736_938681743 30 Left 938681736 2:133699260-133699282 CCTCAATGGAGGAGAGGGAAGAG No data
Right 938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938681743 Original CRISPR GCTCTCACCATTCCAGAAGA GGG Intergenic
No off target data available for this crispr