ID: 938682221

View in Genome Browser
Species Human (GRCh38)
Location 2:133703438-133703460
Sequence GACTAGCTGGTCCACTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938682221_938682224 -6 Left 938682221 2:133703438-133703460 CCTACACAGTGGACCAGCTAGTC No data
Right 938682224 2:133703455-133703477 CTAGTCACTTAGTCTAGGCAAGG No data
938682221_938682225 13 Left 938682221 2:133703438-133703460 CCTACACAGTGGACCAGCTAGTC No data
Right 938682225 2:133703474-133703496 AAGGCTGTTGTTTCCATGCCTGG No data
938682221_938682227 29 Left 938682221 2:133703438-133703460 CCTACACAGTGGACCAGCTAGTC No data
Right 938682227 2:133703490-133703512 TGCCTGGTGCTAGAGCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938682221 Original CRISPR GACTAGCTGGTCCACTGTGT AGG (reversed) Intergenic
No off target data available for this crispr