ID: 938682328

View in Genome Browser
Species Human (GRCh38)
Location 2:133704253-133704275
Sequence GGCCCCATGATAGCTACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938682325_938682328 4 Left 938682325 2:133704226-133704248 CCTTGTGGATCCATCATCTCAAC No data
Right 938682328 2:133704253-133704275 GGCCCCATGATAGCTACAATAGG No data
938682327_938682328 -6 Left 938682327 2:133704236-133704258 CCATCATCTCAACACACGGCCCC No data
Right 938682328 2:133704253-133704275 GGCCCCATGATAGCTACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938682328 Original CRISPR GGCCCCATGATAGCTACAAT AGG Intergenic
No off target data available for this crispr