ID: 938682828

View in Genome Browser
Species Human (GRCh38)
Location 2:133709610-133709632
Sequence TCCCCTCTCACCTGCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938682828_938682834 21 Left 938682828 2:133709610-133709632 CCTGGAGAGCAGGTGAGAGGGGA No data
Right 938682834 2:133709654-133709676 AGATTATCGGTACACACAAATGG No data
938682828_938682830 8 Left 938682828 2:133709610-133709632 CCTGGAGAGCAGGTGAGAGGGGA No data
Right 938682830 2:133709641-133709663 AGTTCCACCTGCCAGATTATCGG No data
938682828_938682835 28 Left 938682828 2:133709610-133709632 CCTGGAGAGCAGGTGAGAGGGGA No data
Right 938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938682828 Original CRISPR TCCCCTCTCACCTGCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr