ID: 938682831

View in Genome Browser
Species Human (GRCh38)
Location 2:133709645-133709667
Sequence TGTACCGATAATCTGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938682831_938682835 -7 Left 938682831 2:133709645-133709667 CCACCTGCCAGATTATCGGTACA No data
Right 938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG No data
938682831_938682837 4 Left 938682831 2:133709645-133709667 CCACCTGCCAGATTATCGGTACA No data
Right 938682837 2:133709672-133709694 AATGGAGCCAGGACTTGGAGAGG No data
938682831_938682836 -1 Left 938682831 2:133709645-133709667 CCACCTGCCAGATTATCGGTACA No data
Right 938682836 2:133709667-133709689 ACACAAATGGAGCCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938682831 Original CRISPR TGTACCGATAATCTGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr