ID: 938682835

View in Genome Browser
Species Human (GRCh38)
Location 2:133709661-133709683
Sequence CGGTACACACAAATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938682828_938682835 28 Left 938682828 2:133709610-133709632 CCTGGAGAGCAGGTGAGAGGGGA No data
Right 938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG No data
938682831_938682835 -7 Left 938682831 2:133709645-133709667 CCACCTGCCAGATTATCGGTACA No data
Right 938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG No data
938682832_938682835 -10 Left 938682832 2:133709648-133709670 CCTGCCAGATTATCGGTACACAC No data
Right 938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938682835 Original CRISPR CGGTACACACAAATGGAGCC AGG Intergenic
No off target data available for this crispr