ID: 938685442 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:133733349-133733371 |
| Sequence | GCCACTGGTTGCTAAACTTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938685442_938685452 | 30 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
| Right | 938685452 | 2:133733402-133733424 | TCATAACTGATACCCTGGCTAGG | No data | ||||
| 938685442_938685450 | 25 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
| Right | 938685450 | 2:133733397-133733419 | AGCCATCATAACTGATACCCTGG | No data | ||||
| 938685442_938685447 | 1 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
| Right | 938685447 | 2:133733373-133733395 | AGGTTTCTGTAACCCTCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938685442 | Original CRISPR | GCCACTGGTTGCTAAACTTA GGG (reversed) | Intergenic | ||