ID: 938685442 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:133733349-133733371 |
Sequence | GCCACTGGTTGCTAAACTTA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938685442_938685452 | 30 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
Right | 938685452 | 2:133733402-133733424 | TCATAACTGATACCCTGGCTAGG | No data | ||||
938685442_938685450 | 25 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
Right | 938685450 | 2:133733397-133733419 | AGCCATCATAACTGATACCCTGG | No data | ||||
938685442_938685447 | 1 | Left | 938685442 | 2:133733349-133733371 | CCCTAAGTTTAGCAACCAGTGGC | No data | ||
Right | 938685447 | 2:133733373-133733395 | AGGTTTCTGTAACCCTCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938685442 | Original CRISPR | GCCACTGGTTGCTAAACTTA GGG (reversed) | Intergenic | ||