ID: 938685445

View in Genome Browser
Species Human (GRCh38)
Location 2:133733364-133733386
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938685445_938685454 19 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685454 2:133733406-133733428 AACTGATACCCTGGCTAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 101
938685445_938685450 10 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data
938685445_938685452 15 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685445_938685453 18 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685453 2:133733405-133733427 TAACTGATACCCTGGCTAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938685445 Original CRISPR GGTTACAGAAACCTGGCCAC TGG (reversed) Intergenic