ID: 938685450

View in Genome Browser
Species Human (GRCh38)
Location 2:133733397-133733419
Sequence AGCCATCATAACTGATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938685442_938685450 25 Left 938685442 2:133733349-133733371 CCCTAAGTTTAGCAACCAGTGGC No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data
938685446_938685450 3 Left 938685446 2:133733371-133733393 CCAGGTTTCTGTAACCCTCAGCA No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data
938685443_938685450 24 Left 938685443 2:133733350-133733372 CCTAAGTTTAGCAACCAGTGGCC No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data
938685440_938685450 26 Left 938685440 2:133733348-133733370 CCCCTAAGTTTAGCAACCAGTGG No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data
938685445_938685450 10 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685450 2:133733397-133733419 AGCCATCATAACTGATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938685450 Original CRISPR AGCCATCATAACTGATACCC TGG Intergenic