ID: 938685452

View in Genome Browser
Species Human (GRCh38)
Location 2:133733402-133733424
Sequence TCATAACTGATACCCTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938685445_938685452 15 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685446_938685452 8 Left 938685446 2:133733371-133733393 CCAGGTTTCTGTAACCCTCAGCA No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685442_938685452 30 Left 938685442 2:133733349-133733371 CCCTAAGTTTAGCAACCAGTGGC No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685448_938685452 -6 Left 938685448 2:133733385-133733407 CCCTCAGCAGGAAGCCATCATAA No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685443_938685452 29 Left 938685443 2:133733350-133733372 CCTAAGTTTAGCAACCAGTGGCC No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data
938685449_938685452 -7 Left 938685449 2:133733386-133733408 CCTCAGCAGGAAGCCATCATAAC No data
Right 938685452 2:133733402-133733424 TCATAACTGATACCCTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938685452 Original CRISPR TCATAACTGATACCCTGGCT AGG Intergenic